Robert D Coleman: Pesticide compositions and methods for their use. Edward E Sowers, Brannon & Sowers PC, October 26, 2010: US07820594 (2 worldwide citation)

This invention relates to agricultural compositions, particularly pesticidal compositions which find particular use as a fungicide or herbicide composition. The pesticidal composition can include one or more fatty acids and one or more organic acids different from the fatty acid. The organic acid ca ...

Robert D Coleman: Fungicide compositions. Edward E Sowers, Brannon & Sowers PC, June 22, 2010: US07741244 (2 worldwide citation)

This invention relates to agricultural compositions that find particular use as a fungicide composition. The fungicide composition can include one or more fatty acids and one or more organic acids different from the fatty acid. The organic acid can but need not exhibit any fungicidal activity; howev ...

Thomas R Sinclair, Carlene A Chase, Daniel O Chellemi, Frank Fornari: Noxious weed control by soil solarization. The United States of America represented by the Secretery of Agriculture, University of Florida, M Howard Silverstein, John D Fado, G Byron Stover, February 20, 2001: US06189466

A method of controlling noxious weeds, particularly nutsedge (Cyperus spp) by soil solarization, comprising covering the soil with an effective thickness of a transparent, thermoplastic IR retentive film for a sufficient period of time to either kill or suppress the weeds. Also a field management me ...

Liu Chengde, Chen Jixuan, Liu Ning: Method for preparing thidiazuron as active substance used for plant quality-promoting and yield-increasing product and its application. Xianyang Defeng, January 16, 2008: CN200710018496

The invention relates to a thidiazuron which is taken as an active matter for the preparation method and application of the product of the quality improvement and production increase of the plant; the content of the thidiazuron in weight percentage is from 0.01 percent to 20 percent, or which in wei ...

Du Juan, Duan Dandan, Ma Lanqing, Shi Guanglu, Wang Yan, Wang Younian: Methyl linoleate acaricide and preparation method therof. Beijing University of Agriculture, June 16, 2010: CN201010000593

The invention relates to a plant acaricide suitable for preventing and controlling mites on cash crops, i.e. fruit trees, vegetables, and the like as well as a preparation and application thereof. The plant acaricide is prepared by adding a surface active agent, an emulsifying agent, a penetrating a ...

Gan Xiuqin, He Huyi, He Zhangjie, Hu Bo, Li Yanying, Lu Liuying, Mo Runxiu, Ning Xiucheng, Shen Zhangyou, Wei Benhui, Wei Guangpo, Wu Yanyong, Yu Jian: Method for planting dryland crops by crashing soil. Institute of Cash Crops, Guangxi Zhuang Autonomous Region Academy of Agricultural Sciences, Deng Xiaoan, July 21, 2010: CN201010125942

The invention discloses a method for planting dryland crops. A rotavator is utilized to deeply loosen and crash the soil in furrows so as to crash the loose soil in a cultivated layer and plough sole and make a portion of foreign soil in the plough sole rise up to be naturally mixed with the soil in ...

Wu Zhiming, Xie Xiaoliang, Chen Jinfeng, Wang Yuhai, Wen Chunxiu, Liu Ming, Tian Wei, Zhou Qiaomei, Dong Wenqi: Anti-aphides gene PPA, preparation thereof and protein encoded thereby. Institute of Cash Crops of Hebei Academy of Agriculture and Forestry Sciences, Wang Qi, August 5, 2009: CN200910073815

The invention belongs to the preparation of a novel gene, and more particularly relates to an aphid-resistant gene (PPA) and a preparation thereof and a protein using the aphid-resistant gene for coding. The 5' end of TCTAGAATGGCCTCCAAGCTCCTCCTC and the 3' end of CCCGGGC TACGCGGCAATTGGGCGCTT are tak ...

Li Tailian, Liang Jun, Zhou Tiejun: High-efficiency organic granulated fertilizer and preparation method thereof. Shaanxi Huaxia Agricultural Technology Development, Li Zhengjian, June 9, 2010: CN200910219347

The invention discloses a high-efficiency organic granulated fertilizer and a preparation method thereof. The fertilizer comprises the following raw materials in percentage by weight: 10-78% of molasses fermentation liquid, 10-40% of fulvic acid and 10-70% of substrate, wherein the sum of the percen ...

Xie Yong, Zhou Chaoai, Jiang Qiyin, Zhang Chenglai, Liang Daozheng: Disinfectant compound containing cyproconazole. Chengdu Huangpai Crop Science, April 28, 2010: CN200910221031

The invention relates to a disinfectant compound with synergy function. The compound contains more than two active ingredients and acceptable agricultural inert ingredient, wherein component A is cyproconazole and component B is one of methoxyl acrylic ester disinfectant compound containing kresoxim ...

Zhang Rongsheng: Boric fertilizer water dispersing granule and preparing method thereof. Shenzhen Longtai Bio Technology, September 16, 2009: CN200910106597

The invention belongs to a new boric fertilizer, referring to a boric fertilizer water dispersing granule and preparing method thereof. The invention comprises one or more than one boric fertilizers and at least one surfactant; the materials are processed as the regular or irregular granules water d ...

Click the thumbnails below to visualize the patent trend.